Maharashtra State Board Class 12th Biology Question Paper 2023 with Solutions Answers Pdf Download.
Class 12 Biology Question Paper 2023 Maharashtra State Board with Solutions
Time : 3 Hrs.
Total Marks: 70
Section – A
Question 1.
Select and write the correct answer for the following multiple choice type of questions: (10)
(i) Histones are rich in ____?
(a) Lysine and Arginine
(b) Leucine and Methionine
(c) Serine and Leucine
(d) Phenylalanine and Lysine
Answer:
(a) Lysine and Arginine
(ii) How many mitotic divisions take place during the formation of a female gametophyte from a functional megaspore?
(a) One
(b) Two
(c) Three
(d) Four
Answer:
(c) Three
(iii) Which of the following is the only gaseous plant growth regulator?
(a) ABA
(b) Cytokinin
(c) Ethylene
(d) Gibberellin
Answer:
(c) Ethylene
(iv) The pH of nutrient medium for plant tissue culture is in the range of ……..
(a) 2 to 4.2
(b) 5 to 5.8
(c) 7 to 7.5
(d) 8 to 9.5
Answer:
(b) 5 to 5.8
(v) Rivert Popper Hypothesis is an analogy to explain the significance of
(a) Biodiversity
(b) natality
(c) Sex-ratio
(d) age distribution ratio
Answer:
(a) Biodiversity
(vi) Which of the following grou shows ZW-ZZ type of sex determination?
(a) Pigeon, Parrot, Sparrow
(b) Parrot, Bat, Fowl
(c) Bat, Fowl, Crow
(d) Sparrow, Fowl, Cat
Answer:
(a) Pigeon, Parrot, Sparrow
(vii) In Hamburger’s phenomenon
(a) Cl– diffuse into WBCs
(b) Cl– difuse into RBCs
(c) Na+ diffuse into RBCs
(d) Na+ diffuse into WBCs
Answer:
(b) Cl– difuse into RBCs
(viii) Calcium and Phosphate ions are balanced between blood and other tissues by ____.
(a) Thymosin and Parathormone
(b) Calcitonin and Somatostatin
(c) Collip’s hormone and Calcitonin
(d) Calcitonin and Thymosin
Answer:
(c) Collip’s hormone and Calcitonin
(ix) Identify the INCORRECT statement.
(a) In a flaccid cell, T.P. is zero
(b) In a turgid cell, DPD is zero
(c) In a fully turgid cell, TP = OP
(d) Water potential of pure water is negative
Answer:
(d) Water potential of pure water is negative
(x) Which of the following is hormone releasing contraceptive?
(a) Cu-T
(b) Cu-7
(c) Multiload-375
(d) LNG-20
Answer:
(d) LNG-20
Question 2.
Answer the following questions: (8)
(i) Which disease is caused by HPV?
Answer:
Genital warts.
(ii) Which device is used to clean both dust and gases from polluted air?
Answer:
Electrostatic Precipitator
(iii) Mention the name of sterile animal produced by intergeneric hybridisation.
Answer:
Mule/Hinny.
(iv) Give the name of first transgenic plant.
Answer:
Tobacco
(v) A child has low BMR, delayed puberty and mental retardation. Identify the disease.
Answer:
Cretinism
(vi) Identify ‘A’ in the given graph of population growth:
Answer:
A → stationary phase
(vii) Complete the following box with reference to symptoms of mineral deficiency:
Answer:
Mottling
(viii) Give an example of plant having both kidney and dumb bell shaped guard cells in stomata.
Answer:
Cyperus.
Section – B
Attempt any EIGHT of the following questions: (16)
Question 3.
Define the terms:
(a) Gross Primary Productivity
(b) Net Primary Productivity
Answer:
(a) GPP-Gross primary productivity: It is the total amount production of the organic matter during photosynthesis.
(b) NPP-Net Primary Productivity: It is the total amount of food or biomass produced by producers excluding energy losses.
NPP = GPP – Respiratory loss
Question 4.
Draw a neat diagram of thyroid gland and label thyroid follicle, follicular cells and blood capillaries.
Answer:
Question 5.
(a) Give reason – ABA is also known as antitranspirant.
(b) Explain the role of chlorophyllase enzyme in banana.
Answer:
(a) ABA – Abscissic acid is also called stress hormone.
It causes efflux of K+ ions from guard cells and this results in closure of stomata. So, it is known as anti-transpirant.
(b) Chlorophyllase enzyme causes degreening effect in banana.
Question 6.
Complete the chart showing human proteins produced by rDNA technology to treat human disease and re-write.
Answer:
Disorders/diseases | Recombinant Proteins |
Anaemia | Erythropoietin |
Asthma | Interleukin-1-receptor |
Blood clots | Tissue plasminogen activator |
Emphysema | α, – antitrypsin |
Question 7.
(a) Define-Imbibition
(b) Explain how imbibition helps root hairs in adsorption of water.
Answer:
(a) Imbibition—It is swelling up of hdrophilic colloids due to adsorption of water.
(b) Root hairs cell wall is made up of pectic compounds and cellulose which are hydrophillic colloids.
Question 8.
Draw a neat diagram of the conducting system of human heart and label AV node, Bundle of His and Purkinje fibres.
Answer:
Question 9.
Distinguish between heterochromatin and euchromatin with reference to staining property and activity.
Answer:
Heterochromatin | Euchromatin |
It stains strongly and appears dark | It stains lightly. |
It is mostly genetically inactive. | It is genetically active. |
Question 10.
Complete the following chart regarding energy flow in an ecosystem and re-write:
Answer:
Grasshopers | Herbivores |
Primary Producer | Grass |
Tertiary Consumer | Man, Lion |
Secondary consumer | Birds, fish |
Question 11.
(a) What is biofortilication?
(b) Mention one example each of fortification with reference to:
(i) Amino acid content
(ii) Vitamin-C content
Answer:
(a) Biofortification: It is a method in which crops are breed (produced) for having higher levels of vitamins, minérals and fats.
(b) Eg: Fortified maize having twice the amount of amino-acids lysine and tryptophan.
Eg: Vitamin C enriched bitter gourd, tomato.
Question 12.
Differentiate between X-chromosome and Y-chromosome with reference to:
(a) length of non-homologous regions
(b) type as per position of centromere.
Answer:
X-chromosome | Y-chromosome | |
Length of non-homologous regions | It is longer and contains more genes. | It is shorter and contains less genes. |
Centromere | Metacentric | Acrocentric |
Question 13.
Define the terms:
(a) Genetic drift
(b) Homologous organs
Answer:
(a) Genetic drift Any alterations in allele frequency in the natural population by pure chance is called genetic drift
(b) Homologous organs: are those organs which are structurally similar but perform different functions.
Question 14.
(a) What is ex-situ conservation?
(b) Mention any two places where the ex-situ conservation is undertaken.
Answer:
(a) Ex. Siw conservation: when a species is critically endangered, special measure have to be under taken to protect it. It might be protected in captivity, as one of the measures of protection.
(b) Eg. Seed banks, Botanical gardens.
Section – C
Attempt any EIGHT of the following questions: (24)
Question 15.
(a) Define- Incomplete dominance.
(b) If a red flowered MirabilisjaLapa plant is crossed with a white flowered plant, what will be the phenotypic ratio in F2 generation? Show it by a chart.
Answer:
(a) Incomplete Dominance: In this both the alleles (genes) of an automorphic pair express themselves partially.
(b) Parents: Red flowers × White flowers
Question 16.
(a) Differentiate between sympathetic and parasympathetic nervous system with reference to the following:
(i) Pre and post ganglionic nerve fibres.
(ii) Effect on heart beat.
(b) Given reason: All spinal nerves are of mixed type.
Answer:
(a)
Sympathetic Nervous System | Parasympathetic Nervous System | |
Pre and post-ganglionic nerve fibres. | 1. Pre ganglionic nerve fibers are short. | Preganglionic nerve fibers are long. |
2. Postganglionic nerve fibres are long increases | Post ganglionic nerve fibres are short decreases. | |
Heart Beat | Increases | Decreases |
(b) Spinal Nerves consist of both sensory nerve and motor nerve hence, it is called as mixed nerve.
Question 17.
(a) Draw a suitable diagram of replication of eukaryotic DNA and label any three parts.
(b) How many amino acids will be there in the polypeptide chain formed on the following mRNA? 5’GCCACAUGGAGAUGACGACAAAAUUUUACUAGAAAA3′
Answer:
(a)
(b) Stop codon = AUG
Stop codon = UAA, UAG, and UGA
8 amino acids will be three in a chain of polypeptide.
Question 18.
Describe the steps in breathing.
Answer:
Breathing involves two steps: Inspiration and Expiration.
Inspiration: During inspiration, the atmospheric air is taken in to the lungs. It occurs due to the pressure gradient formed between the lungs and the atmosphere. It is an active process in which the diaphragm becomes flat and goes downward, the external intercostal muscles contract so the ribs and sternum move upward and outward. This leads to an increase in the thoracic volume and a decrease in pressure of thorax and the Lungs. To equalize the low pressure inside the lungs, air from the atmosphere rushes into lungs. This is inspiration.
Expiration: During expiration, the thorax contracts causing air to be exhaled. The diaphragm relaxes and is pushed upwards. It becomes dome shaped. The intercostal muscles also relax pulling the rib cage inward and downward. This causes a decrease in thoracic volume and leads to increase in pressure in the thorax and the lungs as compared to the atmospheric pressure. So air from the lungs rushes out. This is expiration.
Question 19.
(a) What is spermatogenesis?
(b) Draw a neat and labelled diagram of spermatogenesis.
Answer:
(a) Spermatogenesis: The process of formation of the male garnets (sperm) or spermatozoa from the germinal epithelium of testes.
(b)
Question 20.
(a) What is a connecting link?
(b) Which fossil animal is considered as the connecting link between reptiles and birds? Give any one character of each class found in it.
Answer:
(a) Connecting link: These are fossil forms transitional or intermediate between two groups of organisms. It shows some characters to both the groups.
(b) Archaeopteryx is connecting link between reptiles and birds. It shows presence of long tail, claws and scales on the body.
Avian: Feathery exoskeleton.
Fore limbs are modified into wings.
Question 21.
Complete the following chart regarding population interaction and re-write:
Answer:
Name of Interaction | Interaction between |
1. Parasite | Plasmodium and Man |
2. Competition | Lepard and Lion |
3. Commensalism | Clown fish and Sea-anemone |
Question 22.
(a) What is composition of bio-gas?
(b) Mention any four benefits of bio-gas?
Answer:
(a) Biogas is a mixture of methane CH4(50-60%), CO2 (30-40%), H2S (0-3%), and other gases (CO, N2, H2) in traces.
(b) Benefits: It is a cheap, safe and renewable source of energy.
- It can be easily generated, stored and transported.
- It can be used for domestic lighting, cooking, street lighting as well as in small scale industries.
- It burns with blue flame and without smoke.
- Improves sanitations.
- It is eco-friendly.
Question 23.
(a) Give reason: Water acts as thermal buffer.
(b) Draw a neat and proportionate diagram of root hair and label mitochondria, nucleus and vacuole.
Answer:
(a) Water has high specific heat, high heat of vaporization and high heat of fusion. Due to this, it acts as thermal buffer.
(b)
Question 24.
Explain three main functions of free antibodies produced by B-lymphocytes.
Answer:
Functions of free antibodies:
- Agglutination of particulate matter, including bacteria and viruses. The immobilized mass is than engulfed by phagocytes.
- Opsonisotion / coating of bacteria to facilitate their subsequent phagocytosis by macrophages.
- Neutralization of toxins released by bacteria e.g. tetanus toxin.
Question 25.
(a) Following are the diagrams of entry of pollen tube into ovule. Identify the type A and B.
(b) Give any four points of significance of double fertilization.
Answer:
(a) A—Chalazogamy
B—Mesogamy
(b) Significance of double fertilization
- It is characteristics of Angiosperms.
- Diploid Zygote is formed.
- Triploid (PEN) develops into nutritive endosperm tissue.
- It also helps to avoid polyembryony.
Question 26.
(a) Name the hormone which is responsible for apical dominance.
(b) A farmer wants to remove broad-leaved weeds from the jowar plantation in his field. Suggest any plant hormone to remove such weeds.
(c) Mention any two applications of cytokinin.
Answer:
(a) Auxins
(b) 2,4 – D
(c)
- It promotes cell division and cell elongation.
- It controls apical dominance.
Section – D
Attempt any THREE of the following questions: (12)
Question 27.
(a) What is blood pressure?
(b) Give the name of the instrument which is used to measure the blood pressure.
(c) Differentiate between an artery and a vein with reference to lumen and thickness of wall.
Answer:
(a) The pressure exerted by blood on the watt of blood vessels is called blood pressure.
(b) Sphygmomanometer.
(c)
Artery | Vein | |
Lumen | Narrow | Wide |
Thickness of wall | Thick | Thin |
Question 28.
(a) Describe any three adaptations in anemophilous flowers. Mention any one example of the anemophilous flower.
(b) Describe any three adaptations in hydrophilous flowers. Mention any one example of the hydrophilous flower.
Answer:
(a) The adoptations in anemophitous flowers are:
- Flowers are small and inconspicuous.
- Flowers lack bright colour, nectar and fragrance.
- Petals are green and smalL
Example: Crop plants (wheat, rice etc)
(b) The adaptations in hydrophilous flowers are:
- Flowers are small and inconspicuous.
- Perianth and other floral parts are unwettable.
- Pollen grains are long and unwettable due to presence of Mucilage.
- Nectar and fragrance are absent.
Eg.: Valiisneria.
Question 29.
(a) What is polymerase chain reaction (PCR)?
(b) Describe three steps involved in mechanism of PCR.
Answer:
(a) PCR—PoLmerase Chain Reaction (PCR) is a technique used to create several copies of certain DNA segment.
(b) Steps
Steps (1) — Denaturation (90°-98°C)
— To separate 2 strands of desired DNA.
Step (ii) — Annealing (40-60°C)
— Annealing of primers.
Step (iii) — Elongation (70-75C)
—Taq Polymerase is used to ss DNA as template and adds nucleotides. This is called primer extension.
Question 30.
(a) Give any four significances of fertilization in human.
(b) Mention the names of any two organs each derived from ectoderm and mesoderm.
Answer:
(a) Significance of fertilization in Human:
- 2°-oocyte completes the process of oogenesis and is transformed into mature ovum (s).
- Diploid chromosome number is restored in zygote by process of syngamy.
- Sex of offspring is determined.
(b) Ectoderm—Epidermis of skin hair, nails, sweat glands, salivary glands.
Mesoderm—Connective tissue, dermis of skin, adrenal cortex, heart, blood.
Question 31.
(a) Give any two functions of cerebellum.
(b) Write the names of any four motor cranial nerves with their appropriate serial number.
(c) Which hormones stimulate liver for glycogenesis and glucogenolysis?
Answer:
(a) Functions of cerebellum
- It Equilibrium
- Maintain Body posture
(b) 4-Motor Cranial Nerves.
No. | Name |
III | Occulomotor |
IV | Pathetic |
VI | Abducens |
XI | Spinal accessory |
(c) Insulin stimulate liver for Glycogenesis
Glucagon stimulate liver for Glucogenolysis